# A single FastQ sequence has three components
example <- read.delim("./data/raw/Bihor_Mountain/SRR2998649.part-1.fastq")
show <- paste(c(example[4, ], example[5, ], example[6, ], example[7, ]), collapse = "\n")
message(show)
@SRR2998649.2 ITEWJBF02GOECX length=439
TACGAGGGTATCTAATCCGGTTCGCTCCCCACGCTTTCGTGCCTCAGTGTCAGAAATAGCCTAGTAACCTGCCTACGCCATTGGTGTTCCTTCTAATATCTACGGATTTCACTCCTACACTAGAAATTCCAGTTACCTCTGCTACTCTCGAGTTTGCCAGTTTGAATAATAGTCTGTGTGGTTGAGCCACCAGATTTCACCATTCACTTAACAAACCACCTACGCAACTCTTTACGCCCAGTCACTCCGGATAATGCTTGCACCCTACGTATGACCGCGGCTGCTGGCACGTAGTTAGCCGGTGCTTATTCATAAGTTACCGTCATATTCTTCACTTATAAAAGCAGTTTACGACCCGAAGGCCTTCATCCTGCACGCGGCGTTGCTCCATCAGACTTTCGTCCATTGTGGAAGATTCCTCACTGCTGCCTCCCGTAGG
+SRR2998649.2 ITEWJBF02GOECX length=439
IIIIIHHHIIIIIIIIIIIIIIIIII;;;;IIIIHHHIIIIIIIIIIIIIIIIHHHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHHD666?IIHHHIIIIIIII???IIIIIIIIIIIIIIIIIIIIIIIIIIGGGIIIIIHHHIIIHHHIIIIIIIIIIIIIIIIIIIIIIIIIHHHIIIIIHHHIIII;;;HHHIIIIIIIIIIIIIIHGGHIIIHHHIIIIIIIIIIIIIIIIICCCIH;<<<DIIIIIIIIHHHIIIIIIIIIIIIIIIIIIIIIIIIIIIHHHIIIIIIHHHIIIIIIHHHHIIIIIIIIIIIIICCCBDDIIHHHIIIIHHHIIIIIIIIIIIIHHHIIIIIIIIIIIIIHDCCHIIID@@CCCEE@@@C@@@?@@@@?9<<CC?B@@@EEEEEEE===E7777
Qiime2 uses a compressed type of file format called an ‘Artifact’ for its analyses. Artifacts have different semantic types e.g. FeatureData[Sequence], Phylogeny[Unrooted] depending on the type of data they contain. To begin the analysis, the fastq files were imported into FeatureData[SequencesWithQuality] or FeatureData[PairedEndSequencesWithQuality] artifacts
# Relevant commands
qiime tools import \
--type 'SampleData[PairedEndSequencesWithQuality]' \
--input-path devon.tsv \
--output-path devonFQ.qza \
--input-format PairedEndFastqManifestPhred64V2
qiime tools import \
--type 'SampleData[SequencesWithQuality]' \
--input-path neem.tsv \
--output-path neem.qza \
--input-format SingleEndFastqManifestPhred33V2
The MicFunPred and NCBI databases were obtained in the standard BLAST format, and need to be converted into compatible data types for import into the qiime2 workflow. Specficially, I needed to convert them into FASTA format with an associated taxonomy mapping file (in HeaderlessTSVTaxonomyFormat)
# The database of identifiers
database_example <- read_tsv("./data/blastdb/all_uniqIDs.txt")
database_example
# 1
blastdbcmd -db NCBI_16S/16S_ribosomal_RNA -entry all > NCBI_16S.fasta
blastdbcmd -db micfun/micfun16S -entry all > micfun.fasta
# 2
grep '>' NCBI_16S.fasta | tr -d '>' | sed 's/ /\t/' | sed 's/ /_/g' > NCBI_16SID.txt
grep '>' micfun.fasta | tr -d '>' | sed 's/_/\t/' | sort | uniq > micfunID.txt # Unfortunately several of the headers repeat
# 3
cat micfun.fasta | sed 's/_.*//' > micfunID.fasta
cat NCBI_16S.fasta | sed 's/ .*//' > ncbi16sID.fasta
# 4
cat micfunID.txt NCBI_16SID.txt EzBioCloud/ezbiocloud_id_taxonomy.txt > all_mappings.txt
cat EzBioCloud/ezbiocloud_qiime_full.fasta ncbi16sID.fasta micfun.fasta > all.fasta
qiime tools import --type FeatureData[Taxonomy] --input-format HeaderlessTSVTaxonomyFormat --input-path all.fasta --output-path all_fasta.qza
qiime tools import --type FeatureData[Taxonomy] --input-format HeaderlessTSVTaxonomyFormat --input-path all_uniqIDs.txt --output-path Ids.qza
Altogether, the database contains 130,122 sequences (though there might be some repetition that was overlooked)
# Script for removing redundant ids
from Bio import SeqIO
import csv
exists: set = set()
mapped = open('all_uniq.fasta', 'w+')
for seq in SeqIO.parse('all.fasta', 'fasta'):
if seq.id in exists:
continue
exists.add(seq.id)
mapped.write(f'>{seq.id}\n')
mapped.write(f'{seq.seq}\n')
mapped.close
uniq = open('all_uniqIDs.txt', 'w+')
exists2: set = set()
with open('all_mappings.txt', 'r') as i:
for id in csv.reader(i, delimiter='\t'):
if id[0] in exists2:
continue
exists2.add(id[0])
uniq.write(f'{id[0]}\t{id[1]}\n')
uniq.close
alpha <- get_artifact_data("./results/7-Diversity",
id_key,
extension = "",
metric_list = alpha_metrics
)
faith <- data.frame(row.names = 1:10)
for (site in names(id_key)) {
faith[[id_key[[site]]]] <- alpha[[site]]$fa[, 2]
}
faith_div_plot <- faith %>%
gather() %>%
ggplot(aes(x = value, y = key, fill = key)) +
ggridges::geom_density_ridges2() +
guides(fill = "none") +
labs(y = "Site", x = "Faith diversity")
faith_div_plot
Evenness quantifies the distribution of species in a site; the higher the evenness, the more balanced the number of each species. - Low evenness indicates that a site consists mainly of a few very common species
pi_evenness <- data.frame(row.names = 1:10)
for (site in names(id_key)) {
pi_evenness[[id_key[[site]]]] <- alpha[[site]]$pi[, 1]
}
even_plot <- pi_evenness %>%
gather() %>%
ggplot(aes(x = key, y = value, fill = key)) +
geom_boxplot() +
guides(fill = "none") +
labs(x = "Site", y = "Evenness", title = "Pielou evenness")
even_plot
It’s pretty clear that some sites have much lower evenness than others. Others, like the Barrow mountain sites, Bihor mountains and Catriona snow seem similar from the box plot. Whether or not the difference in evenness is statistically significant can be tested with Kruskal wallis
pi_evenness %>%
select(c(
"Barrow mountain high", "Barrow mountain low",
"Bihor mountains", "Catriona snow"
)) %>%
kruskal.test()
Kruskal-Wallis rank sum test
data: .
Kruskal-Wallis chi-squared = 3.8824, df = 3, p-value = 0.2744
Beta diversity quantifies the distance/dissimilarity between sites and is measured on a scale of 0 (identical) to 1 (completely different).
otu_freqs <- lapply(
get_artifact_data("./results/2-OTUs", id_key, "otuFreqs"),
as.data.frame
)
fasttree <- get_artifact_data(
# Approximate maximum likelihood trees, quick and useful for testing data
"./results/6-RootedTrees", id_key,
"FastTree_RootedTree"
)
iqtree <- get_artifact_data(
# Real maximum likelihood trees, accurate, but slow
"./results/6-RootedTrees", id_key,
"IQTREE_RootedTree"
)
# Annotate an example tree
matched <- match(iqtree$GrI$tip.label, rownames(otu_freqs$GrI))
freq_mapping <- otu_freqs$GrI[matched, ] %>%
rowMeans() %>%
as.data.frame() %>%
`rownames<-`(seq_along(rownames(.)) %>% paste("OTU", ., sep = ""))
iqtree$GrI$tip.label <- paste(rownames(freq_mapping), "freq =", freq_mapping[[1]])
sample_tree <- iqtree$GrI %>%
ggtree(layout = "roundrect", aes(color = "#A4E473")) +
geom_tiplab(size = 3, color = "#004651") +
geom_tippoint(color = "#66CC8A") +
labs(title = "Phylogenetic tree of Cryoconite samples") +
theme(legend.position = "none", axis.text = element_text(size = 5))
sample_tree
Beta diversity calculations on multiple sites at once returns a distance matrix, where the first row and column are sites and entries are. This can be depicted using ordination methods
beta <- get_artifact_data("./results/7-Diversity",
list(Merged = NULL),
extension = "",
metric_list = beta_metrics
)
pcoa2D <- get_artifact_data("./results/8-Analysis",
list(Merged = NULL),
extension = "PCOA-2D_",
metric_list = beta_metrics
)
pcoa2D_merged <- lapply(pcoa2D$Merged, metadata_merge_pcoa, metadata = metadata)
pcoaja <- plot_pcoa(pcoa2D_merged$ja, "Location") +
labs(x = "PC1", y = "PC2", title = "Jaccard distance")
pcoabc <- plot_pcoa(pcoa2D_merged$bc, "Location") +
labs(x = "PC1", y = "PC2", title = "Bray Curtis")
pcoauu <- plot_pcoa(pcoa2D_merged$uu, "Location") +
labs(x = "PC1", y = element_blank(), title = "Unwieghted Unifrac")
pcoawn <- plot_pcoa(pcoa2D_merged$wn, "Location") +
labs(x = "PC1", y = element_blank(), title = "Weighted normalized Unifrac")
pcoa_arrange <- ggarrange(pcoabc, pcoauu, pcoawn,
ncol = 3,
common.legend = TRUE,
legend = "right"
)
pcoa_arrange
The pcoa plots depict clearly how the choice of distance metric affects the clustering of samples.
# Filter the sites
keep <- c("ViS", "BrL", "BrH", "SvG")
filter_wn <- filter_dm(beta$Merged$wn, keep)
filtered_meta <- filter_meta(metadata, keep)
Within the chosen cluster, its visually unclear whether or not the differences between sites are significant. There are specific hypothesis tests for this problem, such as Permutational Analysis of Variance (PERMANOVA) and Analysis of Similarities (ANOSIM)
TODO:what is the difference between them?
adonis2(filter_wn ~ filtered_meta$Location)
anosim(filter_wn, grouping = filtered_meta$Location)
Call:
anosim(x = filter_wn, grouping = filtered_meta$Location)
Dissimilarity:
ANOSIM statistic R: 0.3687
Significance: 0.001
Permutation: free
Number of permutations: 999
# Export for far pro tax database
otu_genus <- list()
for (id in names(id_key)) {
otu_genus[[id]] <- to_genus_csv(otu_freqs[[id]], blast[[id]])
}
genus_combined <- combine_freqs(otu_genus, taxon)
write.csv(combined, "genus_otu_tables.csv", row.names = FALSE)
ko_all <- ko %>%
# Merge the PICRUSt2 tables
reduce(merge, by = "pathway", all = TRUE) %>%
as_tibble() %>%
replace(is.na(.), 0) %>%
rel_abund(., pathway) %>% # Convert to relative abundances
as_tibble()
message(glue("There are {dim(ko_all)[1]} inferred pathways"))
There are 438 inferred pathways
ko_xfunc <- ko_all %>% sites_x_func() # Transpose into sites x function format
ko_all
The raw output tables here are the abundances of inferred biological pathways in each site based on the MetaCyc database.
PICRUSt2 works by first predicting important reactions for metabolism in the site (using KEGG Orthology (KO) and Enzyme Commission numbers (EC)) format, then using their abundances for pathway inference.
Originally I had planned to use the farprotax database for function prediction, but the script the authors provided didn’t work.
# Compute bray curtis distance, then plot pcoa
bc_func <- vegdist(ko_xfunc, method = "bray")
pcoa_bc_func <- bc_func %>%
wcmdscale(k = 2) %>%
metadata_merge_pcoa(metadata, ., functions = TRUE)
# Compute jaccard distance
ja_func <- vegdist(ko_xfunc, method = "jaccard")
pcoa_ja_func <- ja_func %>%
wcmdscale(k = 2) %>%
metadata_merge_pcoa(metadata, ., functions = TRUE)
# Plot and compare with ordination on taxonomy
plot_ja_func <- plot_pcoa(pcoa_ja_func, "Location", functions = TRUE) +
labs(
x = element_blank(), y = element_blank(), title = "Jaccard distance",
subtitle = "From biological pathways"
)
plot_bc_func <- plot_pcoa(pcoa_bc_func, "Location", functions = TRUE) +
labs(
x = "PC1", y = element_blank(), title = "Jaccard distance",
subtitle = "From biological pathways"
)
func_compare <- ggarrange(pcoaja + labs(x = element_blank()), plot_ja_func, pcoabc, plot_bc_func,
ncol = 2, nrow = 2, common.legend = TRUE, legend = "bottom"
) + theme(axis.text = element_text(size = 5))
func_compare
For sample taxonomic classification, I will be trying out all three of the methods available in qiime2:
blast <- lapply(
get_artifact_data("./results/3-Classified", id_key, "BLAST_All"),
parse_taxonomy
)
blast$CaS # The classifications for the Catriona snow site
sklearn <- lapply(
get_artifact_data("./results/3-Classified", id_key, "Sklearn"),
parse_taxonomy
)
sk_merged <- read_qza("./results/3-Classified/Merged-Sklearn.qza")$data %>%
parse_taxonomy()
count_identified(sklearn, "Sklearn")
Sklearn: 0.584407164275873
count_identified(blast, "BLAST")
BLAST: 0.579451912055851
sk_merged
The sklearn classifier has a slightly better number of identifications so will be used for all any downstream analyses
all <- read_qza("./results/2-OTUs/Merged-otuFreqs.qza")$data
sk_merged <- read_qza("./results/3-Classified/Merged-Sklearn.qza")$data %>%
parse_taxonomy()
ranks <- merge_with_id(all, sk_merged, level = 2) %>%
# Collapse taxnomy into phyla
filter(!(is.na(taxon))) %>%
group_by(taxon) %>%
summarise(across(everything(), sum))
not_bacteria <- c(
"Arthropoda", "Nanoarchaeota", "Diatomea", "Altiarchaeota",
"Ascomycota", "Basidiomycota", "Cercozoa", "Ciliophora", "Asgardarchaeota",
"Phragmoplastophyta", "Euryarchaeota", "Crenarchaeota"
) # These are most likely false positives given the specificity of the 16s rRNA primers used to sequence the samples
tax_sum <- sum_by_site(ranks, id_key, "taxon", not_bacteria)
stacked <- tax_sum %>% ggplot(., aes(x = name, y = value, fill = identifier)) +
geom_bar(stat = "identity") +
scale_fill_discrete(name = "Phylum") +
scale_color_paletteer_d("pals::glasbey") +
labs(
x = "Site", y = "Relative abundance", title = "Phyla relative abundance",
subtitle = "*Putative phyla and false positives
(non-prokaryotes) removed"
) +
theme(axis.text = element_text(size = 5))
stacked
shown_paths <- c(
"CHLOROPHYLL-SYN", "GLYCOLYSIS", "TCA", "CALVIN-PWY",
"PENTOSE-P-PWY", "METHANOGENESIS-PWY", "DENITRIFICATION-PWY", "FERMENTATION-PWY",
"LACTOSECAT-PWY", "METH-ACETATE-PWY"
)
nice_paths <- ko_all %>%
filter((grepl(paste(shown_paths, collapse = "|"), pathway)))
path_sum <- sum_by_site(nice_paths, id_key, "pathway", NaN)
heat_path <- path_sum %>% ggplot(., aes(x = name, y = identifier, fill = value)) +
geom_tile() +
scale_fill_gradient2(
name = "Relative abundance",
mid = "seagreen1", low = "springgreen", high = "seagreen"
) +
labs(
x = "Site", y = "Pathway",
)
heat_path
# Differentially abundant taxa between cryosphere types
abc <- ancombc2(
data = tse, assay_name = "counts", tax_level = chosen_rank,
fix_formula = var, group = var,
pairwise = TRUE
)
lfc <- prepare_abc_lfc(abc, "Type", "res_pair", chosen_rank, false_positives)
# Test takes some time to run, so save results
write.csv2(abc$res_pair, "./results/8-ANCOM-BC/all_taxon_res.csv", row.names = FALSE)
write.csv2(lfc, "./results/8-ANCOM-BC/taxon_lfc.csv", row.names = FALSE)
abc_paths <- ancombc2(
data = tse_paths, assay_name = "counts", tax_level = "Species",
fix_formula = "Type", pairwise = TRUE, group = "Type"
)
path_lfc <- prepare_abc_lfc(abc_paths, "Type", "res", NA, NA)
write.csv2(abc_paths$res_pair, "./results/8-ANCOM-BC/all_path_res.csv", row.names = FALSE)
write.csv2(path_lfc, "./results/8-ANCOM-BC/path_lfc.csv", row.names = FALSE)
abc_taxon <- read.csv2("./results/8-ANCOM-BC/all_taxon_res.csv")
taxon_all_counts <- abc_taxon %>%
ancombc_select(glue("diff_{var}"), chosen_rank, false_positives) %>%
select(taxon) %>%
unique() %>%
dim() # Collect counts of all taxa
lfc <- read.csv2("./results/8-ANCOM-BC/taxon_lfc.csv")
percent_abund <- ((length(unique(lfc$taxon)) / taxon_all_counts[1]) %>% round(digits = 2)) * 100
print(glue("Percent of differentially abundant classes: {percent_abund}%"))
Percent of differentially abundant classes: 66%
lfc <- lfc %>% quartile_filter()
# We keep the taxa with the highest and lowest log-fold changes between the types
tax_ids <- as.character(1:length(lfc$taxon))
lfc$taxon <- paste(c(glue("{tax_ids}:")), lfc$taxon)
abc_plot <- abc_lfc_plot(lfc) + scale_fill_discrete(name = "Class") + labs(x = "Type") +
geom_label(aes(label = tax_ids),
label.size = 0.15,
position = position_dodge(width = .9), show.legend = FALSE
)
most_abund <- lfc %>%
filter(lfc == max(lfc)) %>%
select(taxon)
message(glue("The most abundant class is {most_abund}"))
The most abundant class is 51: KD4-96
abc_taxon
abc_plot
The top three most abundant classes TODO: Talk about the most abundant classes and pathways KD4-96 is a uncharacterized class of the phylum Chloroflexi
all_path_lfc <- read.csv2("./results/8-ANCOM-BC/all_path_res.csv")
path_lfc <- read.csv2("./results/8-ANCOM-BC/path_lfc.csv")
path_all_counts <- all_path_lfc %>%
ancombc_select(glue("diff_{var}"), NA, NA) %>%
select(taxon) %>%
unique() %>%
dim()
percent_abund <- ((length(unique(path_lfc$taxon)) / path_all_counts[1]) %>% round(digits = 2)) * 100
print(glue("Percent of differentially abundant pathways: {percent_abund}"))
Percent of differentially abundant pathways: 33
path_lfc <- path_lfc %>% quartile_filter()
ids <- as.character(1:length(path_lfc$taxon))
path_lfc$taxon <- paste(c(glue("{ids}:")), path_lfc$taxon)
abc_pathways <- abc_lfc_plot(path_lfc) +
scale_fill_discrete(name = "Pathway") +
geom_label(aes(label = ids),
label.size = 0.15,
position = position_dodge(width = .9), show.legend = FALSE
)
most_abund <- path_lfc %>%
filter(lfc == max(lfc)) %>%
select(taxon)
message(glue("The most differentially abundant pathway is {most_abund}"))
The most differentially abundant pathway is 49: PWY0-1338
all_path_lfc
abc_pathways
bad_names <- ranks[grep("-", ranks$taxon), ]$taxon
new_names <- bad_names %>% gsub("-", "_", .)
phyla_abund <- ranks %>%
rel_abund() %>%
t() %>%
as.data.frame() %>%
`colnames<-`(.[1, ]) %>%
filter(!(grepl("NzS", rownames(.)))) %>%
select(!all_of((not_bacteria))) %>%
rename_with(~ "Marinimicrobia", "Marinimicrobia_(SAR406_clade)") %>%
rename_with(~ new_names, bad_names) %>%
slice(-1) %>%
rownames_to_column("pred") %>%
mutate_at(.vars = c(1:length(colnames(.)))[-1], .funs = as.numeric) %>%
as_tibble()
phyla_train <- phyla_abund %>%
mutate(pred = lapply(pred, function(x) {
return(filter(metadata, sample.id == x)$Type)
})) %>%
mutate(pred = unlist(pred)) %>%
mutate(pred = as.factor(pred)) # Site needs to be converted to a factor object
num_features <- length(colnames(phyla_train))
message(glue("Trained on {num_features} features"))
Trained on 54 features
# Train the forest
set.seed(2002)
preds <- sample(2, nrow(phyla_train), replace = TRUE, prob = c(0.7, 0.3))
train <- phyla_train[preds == 1, ]
test <- phyla_train[preds == 2, ]
rf <- randomForest(pred ~ ., data = train, proximity = TRUE)
print(rf)
Call:
randomForest(formula = pred ~ ., data = train, proximity = TRUE)
Type of random forest: classification
Number of trees: 500
No. of variables tried at each split: 7
OOB estimate of error rate: 3.53%
Confusion matrix:
Glacier Other Permafrost class.error
Glacier 27 0 0 0.00000000
Other 0 35 1 0.02777778
Permafrost 0 2 20 0.09090909
try <- predict(rf, train)
confusionMatrix(try, train$pred)
Confusion Matrix and Statistics
Reference
Prediction Glacier Other Permafrost
Glacier 27 0 0
Other 0 36 0
Permafrost 0 0 22
Overall Statistics
Accuracy : 1
95% CI : (0.9575, 1)
No Information Rate : 0.4235
P-Value [Acc > NIR] : < 2.2e-16
Kappa : 1
Mcnemar's Test P-Value : NA
Statistics by Class:
Class: Glacier Class: Other Class: Permafrost
Sensitivity 1.0000 1.0000 1.0000
Specificity 1.0000 1.0000 1.0000
Pos Pred Value 1.0000 1.0000 1.0000
Neg Pred Value 1.0000 1.0000 1.0000
Prevalence 0.3176 0.4235 0.2588
Detection Rate 0.3176 0.4235 0.2588
Detection Prevalence 0.3176 0.4235 0.2588
Balanced Accuracy 1.0000 1.0000 1.0000
varImpPlot(rf)